SciELO - Scientific Electronic Library Online

 
vol.22 número1PREVALENCIA DE VIRUS LINFOTRÓPICO HUMANO EN DONANTES DE SANGRE DEL HOSPITAL NACIONAL, PARAGUAYTERAPIA CELULAR PARA EL TRATAMIENTO DE ÚLCERAS CRÓNICAS índice de autoresíndice de materiabúsqueda de artículos
Home Pagelista alfabética de revistas  

Servicios Personalizados

Articulo

Indicadores

Links relacionados

  • No hay articulos similaresSimilares en SciELO

Compartir


Revista Médica La Paz

versión On-line ISSN 1726-8958

Rev. Méd. La Paz vol.22 no.1 La Paz  2016

 

ARTÍCULO ORIGINAL

 

FRECUENCIA DE TRANSCRITOS BCR/ABL P210 EN 272 PACIENTES CON LEUCEMIA MIELOIDE CRÓNICA (LMC) EN BOLIVIA

 

FREQUENCY OF P210 BCR-ABL TRANSCRIPTS IN 272 BOLIVIAN PATIENTS WITH CHRONIC MYELOID LEUKEMIA (CML)

 

 

Ariel Amaru Calzada*, Jose Masias, Eduardo Ustarez, German Choque, Rosario Peñaloza, Silvia Mansilla, Ricardo Amaru

* Unidad de Biología Celular, Facultad de Medicina, Universidad Mayor de San Andrés, La Paz -Bolivia
Correspondencia: Ariel Amaru
e-mail:
a.amaru@icloud.com Unidad de Biología Celular; Facultad de Medicina; Universidad Mayor de San Andrés; La Paz -
Bolivia

RECIBIDO: 09/02/2016
ACEPTADO: 04/05/2016

 

 


RESUMEN

Introducción.- Existen dos formas principales del gen de fusión BCR/ABL, que involucra al exón 2 del gen ABL y a diferentes exones del gen BCR; los transcritos b2a2 o b3a2 codifican a la proteína p210, mientras que, el transcrito e1a2 codifica a la proteína p190. En Bolivia, no existe información sobre la frecuencia de estas isoformas (BCR/ABL quimérico) en pacientes con leucemia mieloide crónica (LMC).

Objetivo.- Determinar la frecuencia de co-expresión de los transcritos p210 en pacientes con LMC de Bolivia.

Material y Método.- Se estudió 272 pacientes diagnosticados con LMC, entre julio del 1999 a agosto del 2015.

Se realizó pruebas de RT-PCR (reverse transcriptase polymerase chain reaction) en muestras de médula ósea y sangre periférica de pacientes adultos y pediátricos con diagnóstico de LMC, positivos para algún tipo de reordenamiento BCR/ABL.

Resultados.- la expresión del transcrito b2a2 se encontró en 96 pacientes (35,3%), el trascrito b3a2 en 154 casos (56,6%) y ambos transcritos en 22 pacientes (8,1%).

Se realizó análisis de supervivencia, donde se observó que a los 5 años la tasa de sobrevida fue 64%; y la sobrevida libre de progresión 42%. También se observó que el tipo de transcrito no influye en la sobrevida total ni en la sobrevida libre de enfermedad.

Conclusión.- Se evidenció que no existen diferencias significativas de la expresión de los diferentes transcritos BCR/ABL de los pacientes estudiados en relación a otros estudios reportados.

Palabras clave: BCR/ABL, LMC, p210, Bolivia, sobrevida.


ABSTRACT

There are two main forms of BCR/ABL fusion gene, involving exon 2 of ABL gene and different exons of the BCR gene, the transcripts b2a2 or b3a2 code for a p210 protein, and the transcript e1a2 code a p190 protein. In Bolivia, there is no information about the frequency of these isoforms of chimeric gene BCR/ABL in chronic myeloid leukemia (CML). The present study was designed to determine the frequency of co-expression of p210 transcripts in 272 patients with CML. It was conducted reverse transcriptase polymerase chain reaction (RT-PCR) tests in samples of bone marrow and peripheral blood of adult and pediatric patients with CML diagnosis, positive for some kind of BCR/ABL rearrangement.

The transcript b2a2 was found in 96 (35,3%) patients; and b3a2 transcript in 154 (56.6%) cases; whereas, in 22 (8.1%) patients both transcripts were detected.

Survival analysis was performed, it was observed that to 5 years the overall survival (OS) was 64%, and the progression free survival (PFS) was 42%. It was also observed that the type of transcript does not affect OS and PFS. Statistical analysis of our study, displayed no significant differences in the expression of different transcripts BCR/ABL of the Bolivian population, in relation to studies reported in other populations.

Keywords: BCR-ABL, LMC, p210, Bolivia, Survival rate.


 

 

INTRODUCCIÓN

La Leucemia Mieloide Crónica (LMC) es una neoplasia mieloproliferativa crónica caracterizada por la presencia de una translocación recíproca entre los brazos largos del cromosoma 9 y 22 - t(9;22)(q34;q11) - daño molecular característico de la LMC(1). El resultado molecular de esta aberración es la formación de un gen híbrido BCR/ ABL en el cromosoma Philadelphia, que es transcrito a un RNA mensajero (RNAm) quimérico. Dependiendo de la localización de la ruptura del gen BCR y ABL, varios tipos de RNAm son formados, siendo los más frecuentes: b2a2 y b3a2; sin embargo en un 5-15% de los casos, está presente la fusión de ambos transcritos (b2a2/b2a3), a causa del splicing alternativo.(2,3)

En Bolivia, la LMC tiene una incidencia del 0,2/100.000 habitantes (Unidad de Biología Celular, Facultad de Medicina, UMSA). Según datos del GLOBOCAN (2012), la leucemia, donde la LMC está incluida, es la primera neoplasia hematológica predominante entre los hombres y la segunda neoplasia hematológica más frecuentemente diagnosticada entre las mujeres, con una incidencia del 4,2/100.000 hab./año y 2,5/100.000 hab./año respectivamente(4).

En la mayoría de los casos de LMC, así como del 30% de las leucemias linfoblásticas agudas Ph+ del adulto y el 20% de las leucemias linfoblásticas agudas Ph+ de los niños, el punto de ruptura el gen BCR se encuentra dentro de la región mayor bcr (M-bcr)(5-7); en esta región ocurre una ruptura entre los exones 13 y 14 (b2) o entre los exones 14 y 15 (b3), que se fusionan con el gen ABL1 a nivel de su exón 2 (a2); esto resulta en un transcrito híbrido BCR/ ABL, que contiene ya sea el exón BCR (b2 o b3) y el exón 2 del gen ABL (a2), y este RNAm codifica una proteína BCR/ ABL de 210 kDa (p210BCR/ABL)(8,9)

De acuerdo a la bibliografía internacional, en la mayoría de las LMC la presentación del transcrito b2a2 es del 35% y del b3a2 es del 56%; mientras que, ambos transcritos (b2a2/b3a2) tienen una frecuencia del 8%, estos últimos datos fueron obtenidos de estudios realizados en países europeos.(10)

En dos tercios de los casos de LLA, así como en casos raros de LMC y de la LMA (leucemia mieloide aguda), el punto de ruptura en el gen BCR se da en la región minor bcr (m-bcr), comprometiendo al exón e1 del BCR, dando lugar al transcrito híbrido e1a2 que se traduce a una pequeña proteína de fusión BCR/ABL de 190 kDa (p190BCR/ ABL). Por otro lado, en algunos casos de LMC se observa el transcrito de fusión c3a2, resultado del punto de ruptura a nivel de la región micro bcr (μ-bcr), entre los exones 19 y 20 del gen BCR que codifica una proteína quimérica de 230 kDa (p230BCR/ABL)(3,11,12).

En diferentes estudios, la prevalencia de los diferentes transcritos en pacientes con LMC ha sido evaluada, a excepción de Bolivia. Reportes precedentes demostraron que la frecuencia de los transcritos de RNAm BCR/ABL en pacientes con LMC no difiere en los diferentes grupos étnicos.(8,13) Al momento no existen datos publicados en relación a la frecuencia de la coexpresión en los transcritos de fusión BCR-ABL en pacientes bolivianos con LMC, utilizando la RT-PCR cualitativa. De la misma manera, no existen datos acerca de la influencia de los tipos de transcrito del gen BCR/ABL en la sobrevida total (OS) y la sobrevida libre de enfermedad (PFS).

El presente estudio fue diseñado con el objetivo de determinar la frecuencia de expresión de los reordenamientos BCR/ ABL en nuestra población.

 

MATERIAL Y MÉTODOS

Pacientes y muestras

Entre julio del 1999 a agosto del 2015, un total de 272 pacientes fueron diagnosticados con LMC, provenientes de distintas regiones de Bolivia. Estos casos fueron estudiados retrospectivamente para evaluar dos isoformas del transcrito de fusión BCR/ ABL: b2a2 y b3a2.

Se obtuvo de 3-5 ml de sangre de médula ósea y sangre venosa periférica recolectadas en tubos con EDTA, luego se utilizó tampón de lisis (NH4Cl, HCO3, EDTA Na2 2H2O), el pellet de glóbulos blancos fue lisado con 300 uL de solución de guanidio (tiocanato de guanidina, lauril sarcosil, citrato de sodio y B-mercaptoetanol) y conservado a -20°C hasta el momento de la extracción del RNA. Se procedió a la extracción con técnica fenol-cloroformo, resuspendido en agua DEPC (dietilpirocarbonato, H2O) y conservado a -20°C hasta el momento del análisis . Una alícuota de 12 uL de RNA fue sometida a retrotranscripción para la obtención del cDNA, utilizando el kit Super Script Reverse Transcriptasa (Invitrogen). Se emplearon 10 uL de cDNA para realizar la amplificación de los transcritos BCR/ABL por PCR utilizando la mezcla de reactivos: Platinum Taq DNA Polymerase 1U (Invitrogen), Buffer 10X (200 mM Tris-HCl pH 8,0, 0,1 mM EDTA, 1mM DTT, estabilizantes, 50% v/v glicerol), MgCl2 1,5 mM, dNTPs 10 mM, agua libre de nucleares con los primers:

BCR-e1-A (GACTGCAGCTCCAATGAGAAC)

BCR-b1-A (GAAGTGTTTCAGAAGCTTCTCC)

ABL-a3-B (GTTTGGGCTTCACACCATTCC)

El programa de amplificación fue: 1er paso, de 10 min a 95°C; 35 ciclos de 30 seg a 94°C, 30 seg a 66°C, 30 seg a 72 °C; y un paso final, de 5 min a 72°C. Los productos amplificados fueron revelados por electroforesis en gel de agarosa al 2% utilizando bromuro de etidio como colorante de revelado.

Los productos de amplificación de los transcritos BCR/ABL corresponden a fragmentos de 417pb para p210 b3a2; 342 pb para p210 b2-a2; y 243 pb para p210 b3-a3.

El análisis de sobrevida fue realizado en 145 pacientes (53,3%) en quienes se pudo realizar un adecuado seguimiento.

Análisis estadístico

El test Chi-quadrado (x2) fue realizado para verificar la diferencia estadística entre la frecuencia obtenida en la población boliviana y otras frecuencias poblacionales reportadas, para ello se utilizó Stata/SE versión 12 y SPSS version 13. El intervalo de confianza (CI) se fijó al 95% y los resultados fueron considerados estadísticamente significativos con p<0,05.

 

RESULTADOS

La edad media de todos los pacientes fue de 42,2 años (2-92 años); en los adultos 44 años (19-92) y en los niños 12 años (2-18). De los 272 pacientes, 166 fueron hombres y 106 mujeres (ratio 1,5:1). La incidencia de las isoformas BCR/ABL fue diferente entre adultos y niños (Tabla 3).

De los 272 casos de LMC, todos expresaron uno de los reordenamientos de p210BCR/ABL (b3a2 o b2a2) (tabla1). De estos casos para p210BCR/ABL, 35,3% (96/272) correspondieron al tipo b2a2, 56,6% (154/272) al b3a2 (ratio b2a2:b3a2 de 1:1,6), y 8,1% (22/272) co-expresaron ambos transcritos (b2a2/b3a2). Estos datos son similares a aquellos descritos en los mexicanos mestizos, caucásicos y de los de India, pero claramente diferentes de aquellos descritos en los mestizos ecuatorianos, mexicanos y los de Sudán. En la Tabla 1, se muestra los resultados de la evaluación de los subtipos del BCR en nuestros pacientes y en la Tabla 2, aquellos obtenidos de otros estudios realizados en diferentes poblaciones en el mundo.

En el análisis de sobrevida, se observó que la tasa de sobrevida fue del 64% a los 5 años, mientras que a los 10 años descendió al 36%. Por otro lado, la sobrevida libre de progresión fue del 42% a los 5 años, mientras que a los 10 años este descendió al 19%.

 

DISCUSIÓN

En el presente estudio, la frecuencia de los reordenamientos de BCR/ABL en Bolivia demostró tener un perfil no tan diferente en contraste con la mayoría de las frecuencias reportadas en algunos estudios similares.

La frecuencia de la expresión del transcrito b2a2 es del 35,3% en nuestra población, este dato no es estadísticamente diferente con respecto a la población caucásica(10) (40%; p =0,5), mestizo mexicana(13) (43,2%; p=0,06), koreana(14) (32,3%;p=0,45) e india(15)(94,6%; p=0,001), México(8)(40%; p =0,002), y Sudán(16) (19.3%; p =0,003).

La isoforma b3a2 tiene una frecuencia del 56,6%, situación similar observada con la población mestizo mexicana (54,2%; p=0,68), caucásica (55%; p =0,82) e india (61,6%; p=0,38); mientras que, estos datos están en contraste con los de Ecuador (5.4%; p =0,001), México (35%; p =0,001), Korea (67,7%; p =0,001) y Sudán (5.5%; p =0,001).

Por otro lado, para el transcrito de co-expresion b2a2/b3a2, en nuestros pacientes se observó un 8,1%, el cual es similar con el de México (7%; p =0,73), India (5%; p =0,42) y Sudán (7.3%; p =0,77); mientras que, es estadísticamente diferente al de los mestizos mexicanos (2,5%; p=0,006) y koreanos (2%; p =0,001).

A pesar de que hasta la fecha, en nuestro país no se han realizado grandes estudios poblacionales de esta enfermedad, la incidencia de la LMC a nivel mundial no es diferente a aquella reportada en otras poblaciones. Las frecuencias de los reordenamientos BCR/ABL, descritas en este estudio, demuestran un perfil similar a frecuencias reportadas en estudios realizados en América y otras regiones geográficas del mundo.

Sin embargo, nuestros datos son diferentes a los reportados por Paz y Miño et al. quienes realizaron un estudio en pacientes mestizos ecuatorianos con LMC, una población étnica similar a la de Bolivia. Al momento, no se puede dar una explicación de esta diferencia más allá del bajo número de pacientes incluidos en el estudio de Paz y Miño et al. o las diferencias metodológicas.

Dichos autores, mencionan que las diferencias entre las frecuencias que reportaron, se deberían a la altitud en la que se encuentra Quito (2763 m.s.n.m), y que la hipoxia podría afectar el comportamiento cromosómico. Sin embargo, en nuestro estudio no encontramos diferencias significativas en la frecuencia de las isoformas cuando comparamos los datos de La Paz (3640 m.s.n.m) con los de Cochabamba (2560 m.s.n.m) y Santa Cruz (380 m.s.n.m) (Figura 1).

En los análisis de OS y PFS (Figura 2), se demostró estadísticamente, que tener una de las diferentes isoformas del gen BCR/ABL no influye en el pronóstico ni en la evolución de la enfermedad.

En resumen, por primera vez este estudio reporta que los reordenamientos del gen de fusión BCR/ABL en pacientes con leucemia mieloide crónica en Bolivia no son diferentes a aquellas publicadas en otras poblaciones del mundo. Por lo tanto, este hallazgo está de acuerdo con la prevalencia encontrada en otros países y grupos étnicos.

Limitaciones del estudio:

No se incluyeron otras fusiones raras de los transcritos como el minor y micro BCR-ABL; por lo tanto, futuros estudios deberían incluir un número mayor de pacientes incluyendo la detección de otros transcritos raros del gen BCR-ABL. Otra limitación fue la falta de seguimiento de los pacientes, por lo que urge adoptar un sistema que permita realizar una vigilancia clínica de los mismos.

 

Agradecimientos.

Se agradece por la revisión y estilo a Daniela Patón y Lizeth Callisaya.

 

REFERENCIAS

1. Verma D, Kantarjian HM, Jones D, Luthra R, Borthakur G, Verstovsek S, et al. Chronic myeloid leukemia (CML) with P190BCR-ABL: analysis of characteristics, outcomes, and prognostic significance. Blood. 2009;114(11):2232-5.

2. Paz-y-Miño C, Burgos R, Morillo SA, Santos JC, Fiallo BF, Leone PE. BCR-ABL rearrangement frequencies in chronic myeloid leukemia and acute lymphoblastic leukemia in Ecuador, South America. Cancer Genetics and Cytogenetics. 2002;132(1):65-7.         [ Links ]

3. Iqbal Z, Manzoor F, Iqbal M, Ali S, Sheikh N, Khan M, et al. Frequency of Bcr-Abl Fusion Oncogene Splice Variants Associated with Chronic Myeloid Leukemia (CML). Journal of Cancer Therapy. 2011;02(02):176-80.         [ Links ]

4. World Health Organization. GLOBOCAN 2012: Estimated Cancer Incidence, Mortality and Prevalence Worldwide in 2012 [cited 2015 23 Nov]. Available from: http://globocan.iarc.fr/Pages/ fact_sheets_population.aspx.

5. Thomas DA, Faderl S, Cortes J, O&apos;Brien S, Giles FJ, Kornblau SM, et al. Treatment of Philadelphia chromosome-positive acute lymphocytic leukemia with hyper-CVAD and imatinib mesylate. Blood. 2004;103(12):4396-407.

6. MD PAB, MD PMS, De Lorenzo PhD P, PhD AC, MD GL, MD VG, et al. Imatinib after induction for treatment of children and adolescents with Philadelphia-chromosome-positive acute lymphoblastic leukaemia (EsPhALL): a randomised, open-label, intergroup study. Lancet Oncology. 2012;13(9):936-45.

7. Leoni V, Biondi A. Tyrosine kinase inhibitors in BCR-ABL positive acute lymphoblastic leukemia. Haematologica. 2015;100(3):295-9.         [ Links ]

8. Arana-Trejo RM, Ruíz Sánchez E, Ignacio-Ibarra G, Báez de la Fuente E, Garces O, Gómez Morales E, et al. BCR/ABL p210, p190 and p230 fusion genes in 250 Mexican patients with chronic myeloid leukaemia (CML). Clinical and laboratory haematology. 2002;24(3):145-50.         [ Links ]

9. Cimino G, Pane F, Elia L, Finolezzi E, Fazi P, Annino L, et al. The role of BCR/ABL isoforms in the presentation and outcome of patients with Philadelphia-positive acute lymphoblastic leukemia: a seven-year update of the GIMEMA 0496trial. Haematologica. 2006;91(3):377-80.         [ Links ]

10. Melo JV. The diversity of BCR-ABL fusion proteins and their relationship to leukemia phenotype. Blood. 1996;88(7):2375-84.         [ Links ]

11. Hermans A, Heisterkamp N, von Linden M, van Baal S, Meijer D, van der Plas D, et al. Unique fusion of bcr and c-abl genes in Philadelphia chromosome positive acute lymphoblastic leukemia. Cell. 1987;51(1):33-40.         [ Links ]

12. Deininger MW, Goldman JM, Melo JV. The molecular biology of chronic myeloid leukemia. Blood. 2000;96(10):3343-56.         [ Links ]

13. Ruiz-Argüelles GJ, Garcés-Eisele J, Reyes-Núñez V, Ruiz-Delgado GJ. Frequencies of the breakpoint cluster region types ofthe BCR/ABL fusion gene in Mexican Mestizo patients with chronic myelogenous leukemia. Revista de investigación clínica; organo del Hospital de Enfermedades de la Nutrición. 2004;56(5):605-8.         [ Links ]

14. Goh HG, Hwang JY, Kim SH, Lee YH, Kim YL, Kim DW. Comprehensive analysis of BCR-ABL transcript types in Korean CML patients using a newly developed multiplex RT-PCR. Translational research : the journal of laboratory and clinical medicine. 2006;148(5):249-56.         [ Links ]

15. Mondal BC, Bandyopadhyay A, Majumdar S, Mukhopadhyay A, Chandra S, Chaudhuri U, et al. Molecular profiling of chronic myeloid leukemia in eastern India. Am J Hematol. 2006;81(11):845-9.         [ Links ]

16. Osman E-AI, Hamad K, Elmula IMF, Ibrahim ME. Frequencies of BCR-ABL1 fusion transcripts among Sudanese chronic myeloid leukaemia patients. Genetics and molecular biology. 2010;33(2):229-31.         [ Links ]

 

Creative Commons License Todo el contenido de esta revista, excepto dónde está identificado, está bajo una Licencia Creative Commons